Wine Science
Identification of strains of Saccharomyces cerevisiae: A microsatellite database of commercial wine strains
This website was established by the Gardner and Goddard labs to summarize our current work in identifying strains of wine yeast using microsatellite loci.
Microsatellites are a simple, reliable form of genotyping, one that is currently used for human fingerprinting and DNA forensic analysis. It is now apparent that they also provide a powerful method for yeast strain identification.
To date we have tested 19 microsatellites with a range of
informativeness. From these, a set of 10, plus the MAT locus, have been
selected and optimized as a multiplex that produces the best strain
discrimination (see Tables below). Genotypes have been obtained for a
selection of 75 commercial strains of wine yeast, as well as for
isolates from New Zealand wineries and a collection of natural yeast
strains from around the world, including those sequenced by SGRP . The
complete list of microsatellite sizes for each strain is provided in
the database -
microsat data.xls (76kB) .
In our hands the microsatellite primers listed here do not work for any species except S. cerevisiae. However, the mating type (MAT) locus primers when used on their own, function for all the tested members within Saccharomyces sensu stricto and give species-specific band sizes (Bradbury et al 2006).
Microsatellite
data analyses
There
are numerous computer programs to assist with the analyses of
microsatellite data. GenAIEx is an ad-in to Excel and is one such
program - this may be downloaded from
http://www.anu.edu.au/BoZo/GenAlEx/genalex_download.php.
GenAIEx provides options for many standard analyses and for export to
file formats for further analyses with other more specialised and
sophisticated programs. A GenAIEx file of the microsatellite data for
the yeasts in our database may be downloaded here
MSat DB GeneAIEx.xls (80kB) .
One way to view the relationships between strains is to calculate the
genetic distance between all pairs of isolates and then convert this
matrix into a tree, or a network - a network is a more accurate way
to present the relationships between these genotypes since, unlike a
binary tree, conflicting and reticulated relationships may be
represented. The pairwise distance matrix generated from the
microsatellite data, using the algorithm implemented by the
codon-genotypic option in GenAIex, may be downloaded here
MSat DB distance matrix.txt (403kB).
Applications such as SplitsTree are able to reconstruct trees and networks from this distances matrix
- the appropriate input file for SplitsTree (and other phylogenetic
applications) is a Nexus file and may be downloaded here.
A tree representing the relationships between all the isolates in our
database, and a network showing the relationships between a range of
commercial wine isolates, are shown below.
Technical information:
DNA was
prepared from colonies or liquid cultures using Chelex (Field et al 1996) and
amplified using the Qiagen multiplex PCR kit (#206143) with standard reaction conditions (54
degrees C annealing).
The band sizes listed were obtained using an ABI 3730 with a DS30 matrix. Primer sequences are given in the Tables below.
For the multiplex data
microsat data.xls (76kB) , sizes were binned to the nearest whole number (eg 99.50-100.49 bases were classified as 100.
In our experience, band sizes can vary by 1-2 bases between
different electrophoresis systems even on the same machine, and by more
using more different systems.
Disclaimer:
All yeast strains were isolated as single colonies in this lab from
original commercial sources. In the majority of cases the strains
listed have not been independently confirmed or otherwise
cross-checked. We take no responsibility for any errors or
inconsistencies in the data.
Microsatellite loci
Locus |
Gene |
Chrom |
Repeat |
Reference |
Alleles* |
Size Range |
| YFR028C | CDC14 | VI | GT | 3(C5) | 26 | 113 - 180 |
| YML091C | RPM2 | XIII | AAT | 1,2 (SCAAT1) | 22 | 245 - 327 |
| YDR160W | SSY1 | IV | AAT | 2 (SCAAT3) | 18 | 379 - 484 |
| YPL009C | - | XVI | CTT | 1 (ORF3) | 17 | 393 - 497 |
| YOL109W | ZEO1 | XV | TAA+TAG | 3 (C4) | 16 | 242 - 361 |
| YLL049W | - | XII | TA | 4 (AT4) | 13 | 270 - 304 |
| YBR240C | THI2 | II | TA | 4 (AT2) | 13 | 336 - 365 |
|
YOR267C
|
HRK1 |
XV
|
CAA
|
1 (ORF2)
|
12
|
395 - 464
|
| YGL139W | - | VII | CAA | 3 (C3) | 10 | 95 - 135 |
| YGL014W | PUF4 | VII | TAA | 3 (C8) | 9 | 124 - 156 |
* number of alleles generated for 75 commercial wine strains
References:
1. Field and Wills 1999
2. Perez et al 2001
3. Legras et al 2005
4. Bradbury et al, 2006
Multiplex arranged by colour and size
Locus |
Label |
Allele sizes |
Alleles |
|
YGL139W |
FAM |
94 - 135 |
10 |
|
YLL049W |
FAM |
270 - 302 |
13 |
|
YBR240C |
FAM |
363 - 391 |
13 |
|
YPL009C |
FAM |
403 - 466 |
17 |
|
MAT alpha |
FAM |
466 (cerev) |
n/a |
|
YGL014W |
NED |
128 - 157 |
9 |
|
YML091C |
NED |
243 - 326 |
22 |
|
YDR160W |
NED |
340 - 465 |
18 |
|
YFR028C |
HEX |
117 - 179 |
26 |
|
YOL109W |
HEX |
242 - 361 |
16 |
|
YOR267C |
HEX |
369 - 460 |
12 |
|
MAT a |
HEX |
489 (cerev) |
n/a |
List of microsatellite primers
Locus |
Primer Sequences |
Repeat1 |
Chromosome |
|
MAT
|
GGTGCATTTGTCATCCGTC
|
- |
III |
|
YML091C |
GTGTCTAAGCCTCTTCAAGCATGAC
|
(AAT)35 |
XIII |
|
YOR267C |
GTGTCTCGATGTTGACGATGATTG
|
(CAA)20 |
XV |
|
YPL009C |
GTGTCTGGGTTTTGGATTTTTATGGA
|
(GAA)16 |
XVI |
|
YDR160W |
GTGTCTGAGGAGGGAAATGGACAG
|
(AAT)23 |
IV |
|
YBR240C |
TTTCCAACCAATCTGCGA
|
(AT)18 |
II |
|
YLL049W |
GCAACATAATGATTTTGAGGT
|
(TA)19 |
XII |
|
YFR028C |
GTGTCTTGACACAATAGCAATGGCCTTCA
|
(GT)30 |
VI |
|
YGL139W |
GTGTCTCTTTTTATTTACGAGCGGGCCAT
|
(CAA)13 |
VII |
|
YGL014W |
GTGTCTCAGGTCGTTCTAACGTTGGTAAAATG
|
(TAA)13 |
VII |
|
YOL109W |
GTGTCTAGGAGAAAAATGCTGTTTATTCTGACC
|
(TAA)13 (TAG)5 |
XV
|
1 Microsatellite repeat in the genome sequence of strain S288C.
References
Field D., Eggert L., Metzgar D., Rose R. and C. Wills (1996).
Use of polymorphic short and clustered coding-region microsatellites to distinguish strains of Candida albicans. FEMS Immunology and Medical Microbiology, 15: 73-79
Field, D. and C. Wills 1998.
Abundant microsatellite polymorphism in Saccharomyces cerevisiae, and the different distributions of microsatellites in eight prokaryotes and S. cerevisiae, result from strong mutation pressures and a variety of selective forces. PNAS 95: 1647-1652
Perez, M. A., F. J. Gallego, I. Martinez and P. Hidalgo 2001.
Detection, distribution and selection of microsatellites (SSRs) in the genome of the yeast Saccharomyces cerevisiaeas molecular markers. Lett Appl Microbiol 33: 461-466
Legras, J.-L., O. Ruh, D. Merdinoglu and K. F. (2005).
Selection of hypervariable microsatellite loci for the characterization of Sacchaormyces cerevisiae. International Journal of Food Microbiology 102:73-83
J.E. Bradbury, K.D. Richards, H.A. Niederer, S.A. Lee, P.R. Dunbar and C. Gardner (2006).
A homozygous diploid subset of commercial wine yeast strains. Antonie van Leeuwenhoek 89: 27-37